NeoBiota 84: 247-266 (2023) A peer-reviewed open-access journal

doi: 10.3897/neobiota.84.90843 &) NeoBiota

https:/ / neobi ota. pen soft. net Advancing research on alien species and biological invasions

Duplex real-time PCR assay for the simultaneous detection of Ophiostoma novo-ulmi and Geosmithia spp. in elm wood and insect vectors

Alessia L. Pepori', Nicola Luchi', Francesco Pecori', Alberto Santini’

| National Research Council — Institute for Sustainable Plant Protection, Via Madonna del Piano, 10, I-50019 Sesto frorentino, Italy

Corresponding author: Alessia L. Pepori (alessia.pepori@ipsp.cnr.it)

Academic editor: Christophe Orazio | Received 25 July 2022 | Accepted 13 February 2023 | Published 18 May 2023

Citation: Pepori AL, Luchi N, Pecori FE Santini A (2023) Duplex real-time PCR assay for the simultaneous detection of Ophiostoma novo-ulmi and Geosmithia spp. in elm wood and insect vectors. In: Jactel H, Orazio C, Robinet C, Douma JC, Santini A, Battisti A, Branco M, Seehausen L, Kenis M (Eds) Conceptual and technical innovations to better manage invasions of alien pests and pathogens in forests. NeoBiota 84: 247—266. https://doi.org/10.3897/neobiota.84.90843

Abstract

Dutch elm disease (DED) is a destructive tracheomycosis caused by Ophiostoma novo-ulmi, an ascomycete probably originating in East-Asia that is devastating natural elm populations throughout Europe, North America and Asia. The fungus is mainly spread by elm bark beetles that complete their life cycle between healthy and diseased elms. Recently, it has been highlighted that some fungi of the genus Geosmithia, which are similarly well associated with bark beetles, seem to also play a role in the DED pathosystem act- ing as mycoparasites of O. novo-ulmi. Although some relationship between the fungi is clear, the biological cycle of Geosmithia spp. within the DED cycle is still partly unclear, as is the role of Geosmithia spp. in as- sociation with the bark beetles. In this work, we tried to clarify these aspects by developing a gPCR duplex TaqMan assay to detect and quantify DNA of both fungi. The assay is extremely sensitive showing a limit of detection as low as 2 fg pl" for both fungi. We collected woody samples from healthy and infected elm trees throughout the beetle life cycle. All healthy elm samples were negative for both Geosmithia spp. and O. novo-ulmi DNA. Geosmithia spp. are never present in infected, but living trees, while they are present in frass of elm bark beetles (EBB — Scolytus spp.) and at each stage of the EBB life cycle in much higher quantities than O. novo-ulmi. This work provides a better understanding of the role and interactions oc- curring amongst the main players of the DED pathosystem.

Keywords DNA quantification, duplex qPCR, Dutch Elm Disease, Geosmithia spp. life cycle, Ophiostoma novo-ulmi, Scolytus multistriatus

Copyright Alessia L Pepori et al. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

248 Alessia L. Pepori et al. / NeoBiota 84: 247-266 (2023)

Introduction

Dutch elm disease (DED) is a destructive tracheomycosis that has devastated natural elm populations throughout Europe, North America and Asia. The disease is caused by two subspecies of Ophiostoma novo-ulmi Brasier, i.e. ssp. novo-ulmi and ssp. americana, previ- ously known as Eurasian (EAN) and North American (NAN) races, respectively (Brasier and Kirk 2001). These ascomycetes are responsible for the ongoing DED pandemic; since the 1970s, they have replaced the less aggressive O. u/mi (Buisman) Nannf. that caused the firsts DED pandemic at the beginning of the last century (Spierenburg 1921).

The fungus is mainly spread by species of elm bark beetles (Coleoptera, Curculioni- dae, Scolytinae) that complete their life cycle between healthy and diseased elms. Bark beetles belonging to the genus Scolytus Geoffroy are the main vectors of O. ulmi s.l. (Webber and Brasier 1984). Specifically, S. scolytus (F.) and S. multistriatus (Marsham), the large and small elm bark beetles (EBB), respectively, are the most common and im- portant species spreading the pathogen worldwide (Webber and Kirby 1983; Webber and Brasier 1984; Webber and Gibbs 1989; Webber 1990, 2000; Faccoli 2001, 2004). The small EBB is the main vector in the Mediterranean area (Santini and Faccoli 2015). During spring, at the time of beetle flight, host plants are more prone to be infected and temperatures are favourable for fungal growth in plant tissue, enhancing the pathogen’s ageressiveness (Santini and Faccoli 2015). Callow adults, carrying the O. novo-ulmi co- nidia, feed at the crotches of 1—2 years-old twigs of adult healthy elm trees to complete their sexual development, thus inoculating the pathogen. Once inoculated, the spores germinate into a growing mycelium and reach the xylem, where the fungus moves into the vessels (Webber and Brasier 1984), inducing the formation of tyloses and gels in the xylem vessels (Stipes and Campana 1981; Rioux et al. 1998; Ouellette et al. 2004a, b; Et-Touil et al. 2005) as a defence response. Later, the beetles move to dying elms to lay eggs in the inner bark of the trunks or branches, which provide the optimal environment for larval development (Rudinsky 1962) and fruiting of the pathogen (Webber and Brasier 1984). New contaminated beetles emerge from the bark to complete the cycle.

Recently, it has been highlighted that other organisms also play roles in the DED pathosystem (Pepori et al. 2018). Some fungi of the genus Geosmithia, a monophyl- etic morphogenus of anamorphic ascomycetes mainly associated with phloem-feeding bark beetles (Kolarik et al. 2004, 2005, 2007, 2008; Kubatova et al. 2004; Kolatik and Jankowiak 2013; McPherson et al. 2013; Jankowiak et al. 2014; Machingambi et al. 2014; Huang et al. 2019; Crous et al. 2022; Meshram et al. 2022), are consistently found in infected elms (Kolarik et al. 2004, 2005, 2007, 2008; Pepori et al. 2015; Huang et al. 2019; Strzatka et al. 2021; Crous et al. 2022).

Geosmithia spp., like O. novo-ulmi, are associated with elm bark beetles (Pepori et al. 2015, 2018) and can similarly be found in beetle larval galleries — thus sharing habitat with O. novo-ulmi — but the ecological niches of these fungi are different. A widespread horizontal gene transfer of the cerato-ulmin gene between O. novo-ulmi and Geosmithia species has been reported (Bettini et al. 2014).

Ophiostoma novo-ulmi and Geosmithia spp. on elm and insect 249

Pepori et al. (2018) demonstrated the existence of a close and stable relationship, which can be classified as mycoparasitism by Geosmithia spp. towards O. novo-ulmi. There are still several gaps in defining the life cycle and lifestyle of elm-related Geosmithia species, especially when they cross and interact with the life cycle of DED fungi.

Previously, several methods of biocontrol of O. novo-ulmi have been investigated and have appeared promising under experimental conditions, although their practi- cal application in the field has been limited (Webber and Gibbs 1984; Webber and Hedger 1986; Sutherland and Brasier 1995; Brasier 2000; Griffin 2000; Hintz et al. 2013; Ganley and Bulman 2016).

An accurate description of the life cycle and identification of the key factors that can enhance the attitude of Geosmithia spp. to act as effective biocontrol agents against O. novo-ulmi may be strategic in controlling the further spread of the disease.

In this study, a new, ad hoc duplex real-time PCR assay, based on TaqMan probe chemistry genus-specific for Geosmithia and species-specific for O. novo-ulmi, for the simultaneous quantification of both fungi from different matrices, was developed. Ap- plication of this molecular approach will fill the knowledge gaps related to the life cycle of Geosmithia spp. and will uncover the tripartite interactions amongst O. novo-ulmi,

Geosmithia spp. and EBBs.

Materials and methods

Fungal strains

The duplex qPCR assay was validated using 12 isolates of Geosmithia spp. belonging to nine different species (G. fassiatiae, G. flava, G. funiculosa, G. langdonii, G. lavendula, G. obscura, G. omnicola, G. pallida and G. putterillii) and eight isolates of Ophiostoma from five species (O. himal-ulmi, O. novo-ulmi ssp. novo-ulmi, O. novo-ulmi ssp. ameri- cana, O. quercus and O. ulmi). Two ubiquitous species were also included as outgroups (Table 1). All fungal strains were obtained from the Institute for Sustainable Plant Pro- tection — National Research Council (IPSP-CNR, Florence, Italy) collection (Table 1). Fungal isolates were grown on 300PT cellophane discs (Celsa, Varese, Italy) on 1.5% Malt Extract Agar (MEA; Difco Laboratories, Detroit, MI) in 90 mm Petri dishes and incubated in the dark at 20 °C. After 10 days, the mycelium was scraped from the surface of the cellophane and stored in 1.5 ml microfuge tubes (Sarstedt, Verona, Italy) at -20 °C. Fungal mycelium (ca. 100 mg fresh weight) was transferred into a 2-ml mi- crofuge tube (Sarstedt) with two tungsten beads (3 mm) (Qiagen, Hilden, Germany) and ground with a Mixer Mill 300 (Qiagen) (2 min; 20 Hz). DNA extraction was performed using the E.Z.N.A. Plant DNA Mini Kit (Omega Bio-tek, Norcross, GA, USA), following the manufacturer's instructions. The concentration of extracted DNA was measured using a Nanodrop ND-1000 spectrophotometer (NanoDrop Technolo- gies, Wilmington, DE, USA).

250

Table |. Fungal strains used in this study.

Alessia L. Pepori et al. / NeoBiota 84: 247-266 (2023)

Species Isolate Code Host Origin Duplex qPCR: (O. novo- ulmi! Geosmithia spp.) Geosmithia fassiatiae CCF3334 Quercus pubescens Czech Republic (-/+) G. flava MK1551 Pteleobius vittatus (on Ulmus laevis) Czech Republic (-/+) G. funiculosa IVV7 U. minor Italy (-/+) G. funiculosa CNR28 U. minor Czech Republic (-/+) G. langdonii MK1643 Scolytus multistriatus (on U. laevis) Czech Republic (-/+) G. langdonii MK1644 Scolytus multistriatus (on U. laevis) Czech Republic (-/+) G. lavendula CCF3394 Chaetopyelius vestitus (on Pistacia Croatia (-/+) terebinthus) G. obscura MK86 Scolytus intricatus (on Quercus robur) Czech Republic (-/+) G. omnicola CNRS5 U. minor Czech Republic (-/+) G. omnicola CNR21 U. minor Czech Republic (-/+) G. pallida MK1622 S. kirschii (on U. minor) Spain (-/+) G. putterillii CCF3342 Scolytus rugulosus (on Prunus sp.) Czech Republic (-/+) Ophiostoma himal-ulmi CBS374.67 U. wallichiana India (-/-) O. novo-ulmi ssp. novo-ulmi CKT11 Ulmus sp. Iran (+/-) O. novo-ulmi ssp. novo-ulmi R64 Ulmus sp. Romania (+/-) O. novo-ulmi ssp. americana H172 Ulmus sp. USA (+/-) O. novo-ulmi ssp. americana H363 Ulmus sp. Ireland (+/-) O. quercus CBS722.95 Quercus sp. Austria (-/-) O. ulmi E2 Ulmus sp. Netherlands (-/-) O. ulmi R21 Ulmus sp. Romania (-/-) Epiccoccum sp. F15 Q. suber Italy (-/-) Cladosporium sp. F1l Q. suber Italy (-/-) “+ = positive qPCR amplification ; — = no amplification products.

Sampling on elm trees and bark beetle collections

Elm bark beetle (EBB) here means exclusively Scolytus multistriatus (Marsham), as it is the most common, active and effective DED vector in Italy and the only one found during sampling.

A total of 123 samples were collected from: i) wood of healthy elm trees; ii) dying elm trees showing DED symptoms (wood from newly-DED infected tissues, wood from old DED infections, living EBB larvae, living EBB pupae and wood frass from maternal and larval galleries); iii) EBB callow adults in flickering traps; and iv) adult females in galleries after oviposition (Table 2). All samples were collected in 1.5 ml microfuge tubes (Sarstedt), frozen in liquid nitrogen and immediately brought to the IPSP-CNR laboratory facilities to be stored in a -80 °C freezer before DNA extraction.

DNA extraction from woody samples and insects

Each woody sample (approx. 100 mg fresh weight from each collected tree and frass) and each insect sample (approx. 5.4 mg fresh weight —containing up to 4 larvae or pu- pae collected alive) was transferred into 2-ml microfuge tubes (Sarstedt), each contain- ing two tungsten beads (Qiagen) and ground with a Mixer Mill 300 (Qiagen) (2 min; 20 Hz). DNA extraction was performed by using the E.Z.N.A. Plant DNA Minikit

Omega Bio-tek), according to the manufacturer’s instructions. (Omeg g

Ophiostoma novo-ulmi and Geosmithia spp. on elm and insect 251

Table 2. List of samples collected and tested in this study.

Source N° of collected Species Sample Geographic orgin (Lat., Long.) samples Healthy trees 8 Ulmus minor Wood Florence, Italy (43.772402°N, 11.176578°E) 6 U. minor Wood Sesto Fiorentino, Italy (43.817554°N, 11.188349°E) New DED 7: U. minor Wood Siena, Italy (43.317361°N, 11.306896°E) infection 4 U. minor Wood Castelnuovo Berardenga, Italy (43.341865°N, 11.519271°E) 3 U. minor Wood Asciano, Italy (43.296617°N, 11.460314°E) Old DED 6 U. minor Wood Bagno a Ripoli, Italy (43.734871°N, 11.324844°E) Infections 4 U. minor wood Montelupo Fiorentino, Italy (43.720481°N, 10.988996°E) =) U. minor Wood Florence, Italy (43.811942°N, 11.240917°E) 2 U. minor Wood Castagneto Carducci, Italy (43.194141°N, 10.567814°E) 2} U. minor Wood Asciano, Italy (43.296617°N, 11.460314°E) 2 U. minor Wood Poggibonsi, Italy (43.476425°N, 11.180486°E) 2 U. minor Wood Castelnuovo di Val di Cecina, Italy (43.267503°N, 10.960795°E) 1 U. minor Wood Asciano, Italy (43.296617°N, 11.460314°E) 1 U. minor ‘CEM187’ — Wood Bagno a Ripoli, Italy (43.734871°N, 11.324844°E) 1 U. minor ‘CEM370° ~~ Wood Bagno a Ripoli, Italy (43.734871°N, 11.324844°E) 1 U. minor Wood Chiusdino, Italy (43.163653°N, 11.088422°E) 1 U. minor Wood Castelnuovo Berardenga, Italy (43.341865°N, 11.519271°E) Frass from 4 U. minor Wood frass Poggibonsi, Italy (43.476425°N, 11.180486°E) EBB galleries 3 U. minor Wood frass Castelnuovo di Val di Cecina, Italy (43.267503°N, 10.960795°E) 3 U. minor Wood frass Sesto Fiorentino, Italy (43.817554°N, 11.188349°E) 2 U. minor Wood frass Chiusdino, Italy (43.163653°N, 11.088422°E) EBB larvae 5 Scolytus multistriatus Larvae Montelupo fiorentino, Italy (43.720481°N, 10.988996°E) 3 S. multistriatus Larvae Castelnuovo di Val di Cecina, Italy (43.267503°N, 10.960795°E) 2 S. multistriatus Larvae Chiusdino, Italy (43.163653°N, 11.088422°E) EBB pupae 4 S. multistriatus Pupae Castelnuovo di Val di Cecina, Italy (43.267503°N, 10.960795°E) 2 S. multistriatus Pupae Montelupo fiorentino, Italy (43.720481°N, 10.988996°E) 2 S. multistriatus Pupae Chiusdino, Italy (43.163653°N, 11.088422°E) EBB in the 5 S. multistriatus Insect Asciano, Italy (43.296617°N, 11.460314°E) galleries 2 S. multistriatus Insect Castagneto Carducci, Italy (43.194141°N, 10.567814°E) 1 S. multistriatus Insect Florence, Italy (43.811942°N, 11.240917°E) 1 S. multistriatus Insect Montelupo fiorentino, Italy (43.720481°N, 10.988996°E) EBB callow 11 S. multistriatus Insect Sesto Fiorentino, Italy (43.817554°N, 11.188349°E) adult 6 S. multistriatus Insect Montelupo fiorentino, Italy (43.720481°N, 10.988996°E) 4 S. multistriatus Insect Florence, Italy (43.811942°N, 11.240917°E) 4 S. multistriatus Insect Castagneto Carducci, Italy (43.194141°N, 10.567814°E) 2 S. multistriatus Insect Chiusdino, Italy (43.163653°N, 11.088422°E) 1 S. multistriatus Insect Bagno a Ripoli, Italy (43.734871°N, 11.324844°E) 1 S. multistriatus Insect Florence, Italy (43.772402°N, 11.176578°E) 1 S. multistriatus Insect Vaglia, Italy (43.890112°N, 11.339246°E)

Total DNA from each adult S. multistriatus beetle collected from flickering traps, as well as in mother and larval galleries, was extracted singly or in batches of four when it came to the beetles collected in the multi-funnel trap. No surface sterilisation was carried out. Beetles were ground by using Mixer Mill 300 (Qiagen) and DNA from the insect’s body was extracted by using the E.Z.N.A. Insect DNA Minikit (Omega Bio-tek), following the manufacturer’s instructions.

Total DNA was checked by agarose gel electrophoresis and was quantified using the Nanodrop ND-1000 spectrophotometer (NanoDrop Technologies). The quality of DNA extracted from elm woody tissue was checked using a SYBR-Green real-time PCR endogenous control for the actin gene, following Pepori et al. (2019).

252 Alessia L. Pepori et al. / NeoBiota 84: 247-266 (2023)

TaqMan MGB probes and primer design

Two sets of primers and TaqMan minor groove binding (MGB) probes were newly de- signed to obtain genus-specific Geosmithia and species-specific Ophiostoma novo-ulmi qPCR markers.

The recently-described G. funiculosa (Crous et al. 2022) is associated with a broad spectrum of bark beetle species that feed on coniferous and deciduous host plants, in- cluding elms and it is phylogenetically close to other Geosmithia species found on elm (Pepori et al. 2015; Crous et al. 2022). Ophiostoma novo-ulmi ssp. americana and ssp. novo-ulmi do not differ at the chosen ITS1 target region. These features made these isolates suitable for their use as standard strains for qPCR assay validation.

Primer and TaqMan MGB probes were designed using Primer Express Software 3.0 (Applied Biosystems Foster City, CA, USA), on the basis of the internal transcribed spac- er (ITS2) region of Geosmithia funiculosa (accession n. KR229885 — isolate CNR28) and ITS1 region for O. novo-ulmi ssp. americana (accession n. EF429091 — isolate 182E). The TaqMan MGB probes were labelled with the reporter dyes 6-carboxyfluorescein (FAM) and VIC at the 5’ end and a minor groove binder non-fluorescent quencher (MGBNEFQ) at the 3’ end. Primers and probes sequences were reported in Table 3.

Homology of the amplicon sequence (both for Geosmithia spp. and Ophiostoma novo-ulmi) with the sequences of other species in the NCBI database was performed using standard nucleotide BLAST (BLASTn) (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Primers were synthesised by Eurofins Genomics (Ebersberg, Germany) and probes by Applied Biosystems (Foster City, CA, USA). Specificity of the primers and probes was also tested by gPCR on DNA from axenic cultures (Table 1), as reported below.

Duplex qPCR assay

Real-time PCR was assayed in MicroAmp Fast 96-well Reaction Plates (0.1 ml) closed with optical adhesive and using the StepOnePlus Real-Time PCR System (Applied Biosystems, Life Science, Foster City, CA, USA). Singleplex and duplex qPCR mixtures and thermo- cycler conditions were tested in this study (data not shown) in order to determine optimal qPCR conditions for the two target pathogens, which were finally set up as follows. Duplex qPCR was performed in a 25 ul final volume containing: 12.5 ul TaqMan Universal Master Mix (Applied Biosystems,), 300 nM each forward primer (OphF and GeoF), 300 nM each reverse primer (OphR and GeoR), 200 nM each TaqMan MGB probe (OphPr and GeoPr) and 5ul genomic DNA. Each DNA sample was assayed in three replicates. Three wells, each containing 5 yl of sterile water, were used as the no-template control (NTC). For singleplex qPCR assay, only one primer set and one TaqMan MGB probe were used and sterile ddH,O was added to reach the final volume (25 pl). The PCR protocol was 50 °C (2 min), 95 °C (10 min), 45 cycles of 95 °C (30 s) and 60 °C (1 min). Data results were analysed using the software SDS 1.9 Sequence Detection System (Applied Biosystems) after manual adjustment of the baseline and fluorescence threshold.

Ophiostoma novo-ulmi and Geosmithia spp. on elm and insect 253

Table 3. Primer and TaqMan MGB probes used in the duplex qPCR assay.

Target Primers and probes Sequences (5’-3”)* Amplicon Tm (°C)? length (bp) Ophiostoma novo-ulmi OphF (Forward primer) GCCGCCCGAACCTTTT 60 58 58 68 OphR (Reverse primer) TGGCTGTTTTTGTTTGTTTCTCA OphPr (TaqMan MGB probe) VIC-AAACCAGTAACGAAACGT-MGBNFQ Geosmithia spp. GeoF (Forward primer) CGCCGTAAAACCCCAACTT 61 59 58 69 GeoR (Reverse primer) GTTCAGCGGGTATTCCTACTTGA

GeoPr (TaqMan MGB probe) FAM-ACCAAGGTTGACCTCG-MGBNFQ

*V1IC=fluorescent label (Applied Biosystems); MGBNFQ= minor groove binder non-fluorescent quencher; FAM= reporter dyes 6-carb- oxyfluorescein. "T= melting temperature.

qPCR specificity and sensitivity assay and standard curve

The specificity of primers and probes (genus-specific for Geosmithia and species-specif- ic for Ophiostoma novo-ulmi) were tested both in singleplex and duplex qPCRs using DNA (at final concentration of 5 ng pl') from axenic cultures of other strains and species of the target organisms, as well as of closely-related species associated with elm and ubiquitous species (Table 1).

The standard curve was generated using DNA from strain CNR28 (G. funicu- losa) and strain 182E (O. novo-ulmi ssp. americana) as standards. For each target species, standard points (ranging from 5 ng pl" to 2 fg ul!) were made using ten 1:5 serial dilutions of standard DNA of both target fungi. Each standard curve was built with standards run in both singleplex and duplex qPCR. The minimum amount of template DNA (limit of detection, LOD) that yielded 100% positive results with the singleplex and duplex assay (qPCR sensitivity) was determined. Three replicates of each dilution were analysed and reactions were repeated at least twice. Quanti- fication of both fungal species DNA in unknown samples was made by interpo- lation from standard curves generated with O. novo-ulmi and G. funiculosa DNA standards that were amplified in the same PCR run. Reproducibility of the GPCR assay was assessed by computing the coefficient of variation (CV) amongst the mean values in eight independent assays. PCR efficiency was calculated against the slope of the standard curve (Eff = 10 -'/’Pe -1) (Bustin et al. 2009), from eight inde- pendent experiments.

Validation of qPCR assay in plant tissues

To evaluate the possible interference of plant DNA extract in the newly-designed qPCR assay, the same ten 1:5 serial dilutions (ranging from 5 ng pl" to 2 fg ul') of fungal DNA (O. novo-ulmi or Geosmithia spp.) were mixed with DNA extracted from healthy elm woody tissue (at 20 ng/tube final concentration) and run on the same qPCR plate of the standard curve (fungal DNA diluted in sterile ddH,O). All samples

were run in triplicate as previously described.

254 Alessia L. Pepori et al. / NeoBiota 84: 247-266 (2023)

Linearity and sensitivity of GPCR on DNA from ascospore serial dilution

To test the linearity and the sensitivity of each qgPCR TaqMan protocol, two different ascospore serial dilutions were obtained from mycelium of axenic culture of Ophiosto- ma novo-ulmi (strain 182E) and Geosmithia funiculosa (strain CNR28). Fungal isolates were grown on MEA media and, after five days, the presence of the ascospores was observed using a Zeiss Axioskop 50 optical microscope. Each ascospore suspension was obtained by scraping the surface of mycelium with a sterile scalpel and then placing it in 1 ml of sterile water. The number of ascospores per ml was determined in a Burker Chamber and, for each pathogen, six 1:10 serial dilutions (1:1 O. novo-ulmi 1.3 x 107 ascospores per ml; 1:1 G. funiculosa 5.6 x 10° ascospores per ml) were prepared. All suspension dilutions were centrifuged for 3 min at 12,000 rpm, the excess water was removed and the ascospore pellets were ground in a 1.5-ml Eppendorf tube using a micropestle (Eppendorf, Hamburg, Germany) in 500 ul of lysis buffer AP1 (EZNA Plant DNA, Omega Bio-tek) and DNA extraction continued with the recommended protocol provided by EZNA Plant DNA kit (Omega Bio-tek, Inc). For each ascospore dilution, 2.5 ul of extracted DNA was assayed using the StepOnePlus Real-Time PCR System (Applied Biosystems) as previously described.

Statistical analysis

For each fungal pathogen (Ophiostoma novo-ulmi and Geosmithia spp.), pairwise com- parison of Cq values of standard points was conducted between duplex and singleplex using the chi-square (y2) test. The Bland-Altman plot was used to determinate the agreement between the two assays (Bland and Altman 1986, 2007). The amount of fungal DNA in insects’ bodies and elm tissues was expressed as pg fungal DNAg total DNA extracted. Differences in Geosmithia spp. and O. novo-ulmi DNA were detected by the analysis of variance (ANOVA), followed by Tukey’s HSD post-hoc test. The significance was evaluated at the 0.05 p-level. Statistical analysis was carried out using

XLSTAT (Addinsoft New York, USA).

Results

Specificity and sensitivity of qPCR assays

BLAST search in NCBI showed 95—100% homology between the designed amplicon sequences and the sequence of Geosmithia species and Ophiostoma novo-ulmi deposited in GenBank.

All DNA from Geosmithia spp. isolates (Table 1) were positively amplified af- ter qPCR, using the Geosmithia-genus-specific assay. The Geosmithia genus-specif- ic assay did not generate any amplicon with DNA from any of the other species tested, such as O. guercus, O. ulmi, O. novo-ulmi, nor with Epiccoccum spp. and

Cladosporium spp.

Ophiostoma novo-ulmi and Geosmithia spp. on elm and insect 255

Ophiostoma novo-ulmi-specific assay successfully amplified DNA from all the O. novo-ulmi strains and it did not generate any amplicon DNA with other Ophiostoma species tested, including O. ulmi, Geosmithia spp. or any of other fungal species tested (Table 1). No differences in terms of specificity between singleplex and duplex were observed for the tested isolates.

The standard curves generated with the singleplex and duplex assays did not sig- nificantly differ for Geosmithia spp. (y* = 0.612; df = 1; P = 0.43) or for O. novo-ulmi (y* = 0.167; df = 1; P = 0.68) (Fig. 1). The high level of agreement between singleplex and duplex platforms was confirmed by Bland-Altman plots (Fig. 1). In general, similar levels of agreement between singleplex and duplex for each target gene were reported, with most C, differences in each comparison falling within the limits of agreements.

The amplification efficiency of duplex qPCR assay was calculated from the slope value of the standard curves according to the equation previously described (Kubista et al. 2006). The slopes of the standard curves were 3.522 for O. novo-ulmi and 3.507 for Geosmithia spp. and these values corresponded to amplification efficiencies ranging from 92.3% to 92.8% (Table 4). The correlation coefficient (r?) was 1 and 0.998 for O. novo-ulmi and Geosmithia spp., respectively, indicating a strong linear relationship between the Cq value and the logarithm of the fungal DNA concentration (Table 4).

The limit of detection (LOD) of both duplex and singleplex qPCR assays were as low as 2 fg ul’ for both Geosmithia spp. and O. novo-ulmi.

The duplex assay revealed no amplification difference between pure fungal DNA (Geosmithia spp. or O. novo-ulmi) in sterile water and the same amounts diluted in a mixture containing DNAs of different organisms (Geosmithia spp., O. novo-ulmi and DNAs from elm wood and insect).

Table 4. Efficiency, linear correlation and assay precision of duplex qPCR assay for the detection of Geosmithia spp. and O. novo-ulmi.

Fungi and variability experiment Efficiency (%) Linear correlation (R’) Coefficient of variation % Geosmithia spp. Intra assay 95.3 0.999 1.18 + 0.13 Inter assay 92.8 0.999 1.3 + 1.07 Ophiostoma novo-ulmi Intra assay 96.8 0.999 1.19 + 0.01 Inter assay 92.3 0.999 1.06 + 0.66

Duplex real-time qPCR from plant tissues and bark beetles

All DNA samples were analysed by duplex qPCR for the quantification of Geosmithia spp. and O. novo-ulmi. No DNA of Geosmithia spp. or O. novo-ulmi was detected in any of the healthy elm samples analysed. Elm samples with recent or previous seasons infections showed the exclusive presence of O. novo-ulmi, with increasing amounts of the pathogen according to the stage of infection (from 18 pg DNAwg total DNA in recent infections to 140 pg DNAig total DNA in older infections) (Fig. 2).

256 Alessia L. Pepori et al. / NeoBiota 84: 247-266 (2023)

Geosmithia spp. Ophiostoma novo-ulmi A 35 B 40 $.,. 30 Fe a5 a, 34 a, ay uy "45 8. ; a0 “a a: Fj be Singleplex “Ha, Singleplex 25 &.,._ yo -3.5408x+ 26.9298 9 ‘*, y= -3,5139% 4 23,583 a R? = 0.9993 hy Rn? = 0.9985 iy 5 ®, 20 Le 3 |) - Si 2, a ae Duplex “we, eee LD yE-315223 + 25.956 he, y=-3.507K + 23.284 ity at *,, 10 R?= 0.9989 "hy m ia 5 5 a a 3 2 1 9 3 3 4 5 4 2 1 Q 2 3 4 5 Log (pe DNA/tube} 07 % 1D +1.96 SD fGbsO my | My (Ce ee a Ep CN a 44 TE ee | ae ee de a ee a SO a Oa INT a? as 5 ns * 7 0.5 e * a4 * “ Mean a, 0.4 : Mean FF og LL J 4 Py ai a3 7. ‘ a2 ae e * 0.2 rr pe ° a4 e 96 5D Ot 0.0 36 5D io} E] 0 15 20 25 30 35 al pelmniadieg Seen an |) laa ne or. inaemianet i; neal Ie----- 5 O1 1

Average Cq Duplex and Singleplex

Figure |. Comparison between singleplex and duplex qPCR A standard curve of Geosmithia spp. and B Ophiostoma novo-ulmi generated with the singleplex (blue dots) and duplex (red dots). For each targeted gene, ten different 1:5 serial dilutions (ranging from 5 ng ul! to 2 fg pl') of Geosmithia spp. and O. novo-ulmi standard DNA were assayed in triplicate. Standard curves were generated by plotting the threshold quantification cycle value (C, value) versus the logarithmic genomic DNA concentration of each dilution series. The Bland-Altman plot for Geosmithia spp. (C) and O. novo-ulmi (D) are shown for the same serial dilutions. The C, difference between the two methods (AC_,, ,) is plotted against the average of both methods (x-axis) for every individual pair of measurements. The interval of the mean of the difference + 1.96 times the standard deviation (SD) defines the 95% interval of the limits of agreement.

Duplex qPCR results revealed the presence of both fungi in all EBB samples, col- lected in different stages of their biological cycle (including samples from frass col- lected in the galleries). In particular, significantly higher quantities of Geosmithia spp. DNA compared to O. novo-ulmi were found on female EBB collected after ovideposi- tion (p < 0.0001, Fig. 2A), corresponding to 63% of the amount of Geosmithia found inside the insect galleries (Fig. 2B). The presence of Ophiostoma detected was signif- cantly lower (p = 0.05) than Geosmithia in all EBB samples analysed, especially in the insects present in the galleries (Figs 2, 3). The quantity of Geosmithia DNA in wood frass and callow adult insects was significantly higher than in pupae and larvae

(p < 0.0001; Fig. 2A).

Ophiostoma novo-ulmi and Geosmithia spp. on elm and insect 257

A Mean of fungal DNA N° of (pg DNAiig total DNA) (4SEM) Source Samples O.7 novo-ulmi Geosmithia spp. Healthy 14 0 0 New DED infection 14 18 (+2) 0 Ulmus spp.“ old DED infection 26 140 (438) 0 Frass from EBB galleries 12 0.28 (40.4) 356 (+108) Larvae 10 0.1 (+0.01) 1.5 (£0.47) Scolytus Pupae 8 0.2 (40.1) 2.2 (0.7) multistriatus Adult in the galleries 9 1.14 (41) 636 (+137) Callow adult 30 0.3 £0.16) 23 (+4.6) B : ae O. novo-ulmi Geosmithia spp.

1% 2%

m Healty trees

1% > ‘ = New DED infection = Old DED infection 35% = Adult in the galleries Frass galleries = Larvae

= Pupae

= Callow adult

Figure 2. Fungal DNA of O. novo-ulmi and Geosmithia spp. on analysed samples by using duplex qPCR assay A Mean of fungal DNA (pg DNA/ug total DNA) + SEM (Standard Error of the Mean) B percent- age presence of O. novo-ulmi and Geosmithia spp. DNA in plant tissues and EBB samples analysed.

Linearity and sensitivity of GPCR on DNA from ascospore serial dilution

DNA extracted from ascospore serial dilution showed a linear relationship for O. novo- ulmi (R? = 0.999) and Geosmithia spp. (R’ = 0.999) (Fig. 4). Fungal DNA quantifica- tion for O. novo-ulmi ranged from 31 pg pl! to 10 fg pl! corresponding to 107 to 107 ascospore/ml; while for Geosmithia spp. from 5.8 pg ul" to 3 fg ul’ corresponding to 10° to 10 ascospore/ml.

Discussion

Dutch Elm Disease is still causing massive damage in Europe and the death of elms is still catastrophic in ecological and economical terms through the loss of genetic di- versity and trees lost from urban and natural forest stands (Santini and Faccoli 2015).

The detection of fungi by traditional methods, such as isolation from plant tis- sues and insect bodies, may be sometimes challenging and time-consuming, seriously

258 Alessia L. Pepori et al. / NeoBiota 84: 247-266 (2023)

@ Geosmithia spp. _@_O. novo-ulmi

Old DED infection New DED infection

Callow adult

Adult in the gallery Frass from galleries Larvae Pupae

Figure 3. Proportion of target DNAs (%) at different DED infection stages.

impairing our knowledge of their biological cycles. In addition, these methods do not allow quantification of the target organism. DNA sequence-based molecular tools, such as real-time PCR, digital PCR or, even if indirectly, LAMP (Hardinge and Mur- ray 2020) and HTS, are increasingly used to enable accurate and specific detection and quantification from any substrate (Lindahl et al. 2013).

Multiplex qPCR is an increasingly utilised method (Bonants and te Witt 2017; Luchi et al. 2018; Rizzo et al. 2020) allowing simultaneous detection of different mi- croorganisms in the same reaction, thus significantly reducing both the quantity of samples and the overall cost of the analysis. The use of a multiplex assay may prove particularly important to distinguish pathogens that cause similar symptoms, as in the case of Fusarium circinatum and. Caliciopsis pinea, which cause comparable symp- toms on Pinus radiata (Luchi et al. 2018) or the study of the four European species of Heterobasidion that attack conifers (Ioos et al. 2019).

In this study, the developed and validated duplex qPCR assay was able to detect and quantify the presence of Geosmithia spp. and O. novo-ulmi from different matrices (frass and plant tissue; adults, larvae and pupae of bark beetles) collected from healthy and DED-symptomatic elms.

This duplex qPCR assay showed high reproducibility and specificity for both genus- specific Geosmithia spp. and species-specific O. novo-ulmi and high sensitivity (LODs 2 fg ul', for both fungi). This assay allowed the detection in elm trees of O. novo-ulmi infections before symptoms had fully developed, as well as the presence of Geosmithia spp. in different host tissues and on the insect body.

Our results confirm that Geosmithia is closely associated to EBB galleries, as also reported by Kolarik et al. (2008), showing extremely high amounts on the EBB female bodies and in maternal gallery frass.

Ophiostoma novo-ulmi and Geosmithia spp. on elm and insect 259

A Geosmithia funiculosa 5 ae i we —— = one oo wee? oe. | Ee I ae o 2 _— y= 1.4925x + 3.6039 a ae? 2 a A ne es: R? = 0.9999 LS ——— oe ee sh ? = a -3 -2.5 -2 -1.5 -1 -0.5 0 0.5 i Log10 spore/ul B Ophiostoma novo-ulmi 6 5 Tie ° a = 4 rd ~ ae? oY a re Qa 3 eo a CT TL y = 1.4887x + 2.869 | a rh R? = 0.9999 2? =i 1 at 0 -2.5 2 -1.5 -1 -0.5 0 0.5 4 1.5 2

Log10 spore/ul

Figure 4. The quantification of A Geosmithia funiculosa and B Ophiostoma novo-ulmi extracted from ascospore dilutions. For each sample, dilution data were reported as the median value of triplicates +SD.

Our observations indicate that the humidity and temperature conditions within the subcortical galleries seem to promote the fitness of the fungi studied here, par- ticularly Geosmithia. In addition, the results show that Geosmithia is always present in beetle galleries along the studied period, but the detected DNA quantity decreases significantly as the insect’s maturation progresses, i.e. from the time of ovideposition until the callow adults flicker.

This study confirms the association between bark beetles and Geosmithia, as also reported by other studies (Kolarik et al. 2008, 2017; Pepori et al. 2018; Huang et al. 2019) and highlights that this association is constant throughout the life of the bark

260 Alessia L. Pepori et al. / NeoBiota 84: 247-266 (2023)

beetle and is not only specific to the subcortical developmental stage. Moreover, fungi benefit from this association because the beetles transport them to new host plants (Paine et al. 1997; Six 2003; Six and Wingfield 2011) and prepare a suitable habitat for their growth. In the galleries dug by insects, the fungi become metabolically more active because they have access to a constant supply of nutrients such as decaying wood (Stokland et al. 2012).

The elm bark beetles are generally unable to digest the lignin, cellulose and hemi- cellulose components that make up xylem tissues (Dadd 1970; Geib et al. 2008) and feed primarily on the phloem. However, for some phloem-feeding beetles, phloem tis- sues remain relatively low in usable nitrogen and sterols and, thus, the associated fungi can serve as a complementary source of nutrients (Six 2012). It has been observed that symbiotic fungi are able to access nitrogen stored in the sapwood and translocate it into the phloem where the larvae and pupae of bark beetle feed (Stokland et al. 2012). Bark beetles and ambrosia beetles, as reported also by Kolarik and Kirkendall (2010) and Veselska and Kolarik (2015), use these fungi as principal nutritional symbionts and recently new Geosmithia species associated with ambrosia beetles have been described in a tropical forest in Costa Rica (Kolarik and Kirkendall 2010).

EBBs are the main vectors of Geosmithia spores on their body and maybe use the fungus as a complement to their nutrition, especially during the larval and pupal stages of their life cycle that takes place within the galleries under the elm bark. However, more studies are needed to confirm this hypothesis.

The callow adults complete their maturation over a few days by digging short feed- ing burrows in the phloem of the twig and sapwood of healthy elms (Fransen 1939; Webber and Brasier 1984), where they deposit the DED fungal spores. This study shows that these insects carry large quantities of Geosmithia and much less of O. novo- ulmi (Fig. 3). The spores of the latter reach the xylem and move in the vessels through a phase of yeast multiplication (Webber and Brasier 1984), giving rise to the infection process. Geosmithia, at least in this first phase, is not detectable and this could mean that it does not find optimal conditions to spread or it is translocated in other parts of the plant. In fact, although the new insects flicker from the bark of dying elms car- rying 99% Geosmithia spores, to the xylem of elm trees experiencing new attacks, we found only the presence of the DED pathogen. ‘These results are in contrast with those reported by Pepori et al. (2018), who found that the artificial inoculation of both fungi in the same elm clone resulted in significantly lower symptoms than single inoculations of O. novo-ulmi. Maybe the reason lies in the fact that artificial inoculations, generally performed in the internodal section of the twig, circumvent the natural plant reaction, while beetles dig their burrow at the twig crotches (Santini and Faccoli 2015).

None of the target DNAs was detected in healthy elm tissues and only O. novo- ulmi DNA was detected in DED-symptomatic plants, confirming that Geosmithia does not adapt to the conditions of living plants tissues or even in xylem of plants with early DED symptoms (Pepori et al. 2018).

These findings show that this fungus is not an endophyte, at least in elm. Instead, Geosmithia was detected in abundance on EBB bodies and in EBB tunnels in decaying plants. Our analyses suggest that the presence of this fungus is mostly associated with

Ophiostoma novo-ulmi and Geosmithia spp. on elm and insect 261

the breeding activity of the vector insect on elm trees as already observed in other stud- ies (Kolarik et al. 2007, 2008; Kolarik and Jankowiak 2013).

In conclusion, the duplex qPCR technique developed in this work is extremely sensi- tive and able to specifically identify and quantify the presence of both O. novo-ulmi and Geosmithia spp. in plants with different levels of DED symptoms, on EBB larvae, pupae and wood frass from maternal and larval galleries and on the body of callow adult insects, providing better insight into the dynamics of this complex fungus-fungus association mediated by S. multistriatus. This work provided solid data on the actual DNA quantity of the two fungi at the different steps of the DED cycle, thus gaining a better under- standing of the role and interactions occurring amongst all the pathosystem players.

Dutch elm disease continues to be extremely damaging on planted and natural elm stands in Europe. Critical thresholds comparable to those that led to the decline of the first epidemic do not appear to have been reached and the current disease dynamic seems likely to continue.

Moreover, an increasingly warming climate could have a great influence on bee- tle epidemics, their aggression, population dynamics and migration (Bentz and Jéns- son 2015), allowing the expansion of the DED epidemic to more northern latitudes (Jiirisoo et al. 2019, 2021).

Several aspects of O. novo-ulmi-Geosmithia-Scolytus interactions within the DED pathosystem need to be further studied and more in-depth information on the bio- logical cycle of Geosmithia spp. during the flickering period of new generations will be essential to use this fungus as a biocontrol agent of DED and finally allow European elms to re-populate the landscape.

Acknowledgements

This study was supported by the HOMED project (http://homed-project.eu/), which received funding from the European Union's Horizon 2020 Research and Innovation Programme under grant agreement No. 771271. We thank Dr. Miroslav Kolatik for providing Geosmithia spp. isolates from Czech Republic, Croatia and Spain. Authors wish to warmly thank Dr. Matthew Duncan Haworth for English language editing. Authors wish to thank the anonymous referees who helped to significantly improve the manuscript.

References

Bentz BJ, Jonsson AM (2015) Modeling bark beetle responses to climate change. Bark beetles. Academic Press, 533-553. https://doi.org/10.1016/B978-0-12-417 156-5.00013-7

Bettini PP, Frascella A, Kolatik M, Comparini C, Pepori AL, Santini A, Scala F, Scala A (2014) Widespread horizontal transfer of the cerato-ulmin gene between Ophiostoma novo-ulmi and Geosmithia species. Fungal Biology 118(8): 663-674. https://doi.org/10.1016/j. funbio.2014.04.007

262 Alessia L. Pepori et al. / NeoBiota 84: 247-266 (2023)

Bland JM, Altman D (1986) Statistical methods for assessing agreement between two methods of clinical measurement. Lancet 327(8476): 307-310. https://doi.org/10.1016/S0140- 6736(86)90837-8

Bland JM, Altman DG (2007) Agreement between methods of measurement with multiple observations per individual. Journal of Biopharmaceutical Statistics 17(4): 571-582. https://doi.org/10.1080/10543400701329422

Bonants P, te Witt RT (2017) Molecular diagnostics in plant health. Molecular diagnostics. Springer, Singapore, 175—202. https://doi.org/10.1007/978-98 1-10-45 11-0_9

Brasier CM (2000) Intercontinental spread and continuing evolution of the Dutch elm dis- ease pathogens. In: Dunn CP (Ed.) The elms: breeding, conservation and disease man- agement. Kluwer Academic Publishers, Dordrecht, The Netherlands, 61—72 https://doi. org/10.1007/978-1-4615-4507-1_4

Brasier CM, Kirk SA (2001) Designation of the EAN and NAN races of Ophiostoma novo- ulmi as subspecies. Mycological Research 105(5): 547-554. https://doi.org/10.1017/ S0953756201004087

Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Wittwer CT (2009) The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments, 611-622. https://doi.org/10.1373/clinchem.2008.112797

Crous PW, Boers J, Holdom D, Osieck, Steinrucken TV, Tan YP, Vitelli JS, Shivas RG, Barrett M, Boxshall A-G, Broadbridge J, Larsson E, Lebel T, Pinruan U, Sommai S, Alvarado P, Bonito G, Decock CA, De la Pefia-Lastra S, Delgado G, Houbraken J, Macia-Vicente JG, Raja HA, Rigueiro-Rodriguez A, Rodriguez A, Wingfield MJ, Adams SJ, Akulov A, AL-Hidmi T, Antonin V, Arauzo S, Arenas F, Armada F, Aylward J, Bellanger J-M, Berraf- Tebbal A, Bidaud A, Boccardo FE, Cabero J, Calledda F, Corriol G, Crane JL, Dearnaley JDW, Dima B, Dovana F, Eichmeier A, Esteve-Raventés F, Fine M, Ganzert L, Garcia D, Torres-Garcia D, Gené J, Gutiérrez A, Iglesias P, Istel L, Jangsantear P, Jansen GM, Jeppson M, Karun NC, Karich A, Khamsuntorn P, Kokkonen K, Kolarik M, Kubatova A, Labuda R, Lagashetti AC, Lifshitz N, Linde C, Loizides M, Luangsa-ard JJ, Lueangjaroenkit P, Mahadevakumar S, Mahamedi AE, Malloch DW, Marincowitz S$, Mateos A, Moreau P-A, Miller AN, Molia A, Morte A, Navarro-Rdédenas A, Nebesdrova J, Nigrone E, Nuthan BR, Oberlies NH, Pepori AL, Rama T, Rapley D, Reschke K, Robicheau BM, Roets F, Roux J, Saavedra M, Sakolrak B, Santini A, Sevtikova H, Singh PN, Singh SK, Somrithipol S, Spetik M, Sridhar KR, Starink-Willemse M, Taylor VA, van Iperen AL, Vauras J, Walker AK, Wingfield BD, Yarden O, Cooke AW, Manners AG, Pegg KG, Groenewald JZ (2022) Fungal Planet description sheets: 1383-1435. Persoonia-Molecular Phylogeny and Evolu- tion of Fungi 48(111): 261-371. https://doi.org/10.3767/persoonia.2022.48.08

Dadd RH (1970) Digestion in insects. In: Florkin M, Scheer BT (Eds) Chemical Zoology VA. Ac- ademic Press, New York, 117-146. https://doi.org/10.1016/B978-0-12-395538-8.50031-8

Et-Touil A, Rioux D, Mathieu FM, Bernier L (2005) External symptoms and histopatho- logical changes following inoculation of elms putatively resistant to Dutch elm disease with genetically close strains of Ophiostoma. Canadian Journal of Botany 83: 656-667. https://doi.org/10.1139/b05-037

Ophiostoma novo-ulmi and Geosmithia spp. on elm and insect 263

Faccoli M (2001) Elm bark beetles and Dutch elm disease: tests of combined control. Journal of Pest Science 74: 22—29. https://doi.org/10.1046/j.1439-0280.2001.00033.x

Faccoli M (2004) Scolytus scolytus (F). Crop Protection Compendium 2004 Edition. CAB International, Wallingford, UK, CD-ROM.

Fransen JJ (1939) Iepenziekte, iepenspintkevers en beider bestrijding. [Elm disease, elm bark beetles and their control] Veenman and Zonen, Wageningen, 118 pp. [in Dutch]

Ganley RJ, Bulman LS (2016) Dutch elm disease in New Zealand: Impacts from eradication and management programmes. Plant Pathology 65(7): 1047-1055. https://doi.org/10.1111/ ppa.12527

Geib SM, Filley TR, Hatcher PG, Hoover K, Carlson JE, Jimenez-Gasco MDM, Tien M (2008) Lignin degradation in wood-feeding insects. Proceedings of the National Academy of Sciences of the United States of America 105(35): 12932-12937. https://doi.org/10.1073/ pnas.0805257105

Griffin GJ (2000) Blight control and restoration of the American chestnut. Journal of Forestry 98: 22-27. https://doi.org/10.1093/jof/98.2.22

Hardinge P, Murray JA (2020) Full dynamic range quantification using loop-mediated amplification (LAMP) by combining analysis of amplification timing and variance between replicates at low copy number. Scientific Reports 10(1): 916. https://doi.org/10.1038/ s41598-020-57473-1

Hintz WE, Carneiro JS, Kassatenko I, Varga A, James D (2013) Two novel mitoviruses from a Canadian isolate of the Dutch elm pathogen Ophiostoma novo-ulmi. (93-1224). Virology Journal 10(1): 252. https://doi.org/10.1186/1743-422X-10-252

Huang YT, Skelton J, Johnson AJ, Kolarik M, Hulcr J (2019) Geosmithia species in southeast- ern USA and their affinity to beetle vectors and tree hosts. Fungal Ecology 39: 168-183. https://doi.org/10.1016/j.funeco.2019.02.005

Ioos R, Chrétien P, Perrault J, Jeandel C, Dutech C, Gonthier P, Hubert J (2019) Multiplex real-time PCR assays for the detection and identification of Heterobasidion species at- tacking conifers in Europe. Plant Pathology 68(8): 1493-1507. https://doi.org/10.1111/ ppa.13071

Jankowiak R, Kolarik M, Bilanskic P (2014) Association of Geosmithia fungi (Ascomycota: Hypocreales) with pine- and spruce-infesting bark beetles in Poland. Fungal Ecology 11: 71-79. https://doi.org/10.1016/j.funeco.2014.04.002

Jiirisoo L, Adamson K, Padari A, Drenkhan R (2019) Health of elms and Dutch elm disease in Estonia. European Journal of Plant Pathology 154(3): 823-841. https://doi.org/10.1007/ s10658-019-01707-0

Jiirisoo L, Selikhovkin AV, Padari A, Shevchenko SV, Shcherbakova LN, Popovichev BG, Drenkhan R (2021) The extensive damage to elms by Dutch elm disease agents and their hybrids in northwestern Russia. Urban Forestry & Urban Greening 63: 127214. https://doi.org/10.1016/j.ufug.2021.127214

Kolatik M, Jankowiak R (2013) Vector affinity and diversity of Geosmithia fungi living on subcortical insects inhabiting Pinaceae species in Central and Northeastern Europe.

Microbial Ecology 66(3): 682-700. https://doi.org/10.1007/s00248-013-0228-x

264 Alessia L. Pepori et al. / NeoBiota 84: 247-266 (2023)

Kolatik M, Kirkendall LR (2010) Evidence for a new lineage of primary ambrosia fungi in Geosmithia Pitt (Ascomycota: Hypocreales). Fungal Biology 114(8): 676-689. https://doi. org/10.1016/j.funbio.2010.06.005

Kolatik M, Kubdtov4 A, Pazoutova S, Sritka P (2004) Morphological and molecular char- acterisation of Geosmithia putterillii, G. pallida comb. nov. and G. flava sp. nov., associ- ated with subcorticolous insects. Mycological Research 108(9): 1053-1069. https://doi. org/10.1017/S0953756204000796

Kolatik M, Kubatova A, Cepicka I, Pazoutova S, Sratka P (2005) A complex of three new white-spored, sympatric, and host range limited Geosmithia species. Mycological Research 109(12): 1323-1336. https://doi.org/10.1017/S0953756205003965

Kolarik M, Kostovéik M, Pazoutova S (2007) Host range and diversity of the genus Geosmithia (Ascomycota: Hypocreales) living in association with bark beetles in the Mediterranean area. Mycological Research 111(11): 1298-1310. https://doi.org/10.1016/j.mycres.2007.06.010

Kolatik M, Kubatova A, Hulcr J, Pazoutova S (2008) Geosmithia fungi are highly diverse and consistent bark beetle associates: Evidence from their community structure in temperate Europe. Microbial Ecology 55(1): 65-80. https://doi.org/10.1007/s00248-007-925 1-0

Kolafik M, Hulcr J, Tisserat N, De Beer W, Kostovéik M, Kolafikova Z, Rizzo DM (2017) Geosmithia associated with bark beetles and woodborers in the western USA: Taxonomic diversity and vector specificity. Mycologia 109(2): 185-199. https://doi.org/10.1080/002 75514.2017.1303861

Kubatova A, Kolarik M, Prasil K, Novotny D (2004) Bark beetles and their galleries: well- known niches for little known fungi on the example of Geosmithia. Czech Mycology 56(1—2): 1-18. https://doi.org/10.33585/cmy.56101

Kubista M, Andrade JM, Bengtsson M, Forootan A, Jonak J, Lind K, Zoric N (2006) The real-time polymerase chain reaction. Molecular Aspects of Medicine 27(2—3): 95-125. https://doi.org/10.1016/j.mam.2005.12.007

Lindahl BD, Nilsson RH, Tedersoo L, Abarenkov K, Carlsen T, Kjoller R, Kauserud H (2013) Fungal community analysis by high-throughput sequencing of amplified markers—a user’s guide. The New Phytologist 199(1): 288-299. https://doi.org/10.1111/nph.12243

Luchi N, Pepori AL, Bartolini P, loos R, Santini A (2018) Duplex real-time PCR assay for the simultaneous detection of Caliciopsis pinea and Fusarium circinatum in pine samples. Applied Microbiology and Biotechnology 102(16): 7135-7146. https://doi.org/10.1007/ s00253-018-9184-1

Machingambi NM, Roux J, Dreyer LL, Roets F (2014) Bark and ambrosia beetles (Curculio- nidae: Scolytinae), their phoretic mites (Acari) and associated Geosmithia species (Ascomy- cota: Hypocreales) from Virgilia trees in South Africa. Fungal Biology 118(5—6): 472-483. https://doi.org/10.1016/j.funbio.2014.03.006

McPherson BA, Erbilgin N, Bonello PB, Wood DL (2013) Fungal species assemblages asso- ciated with Phytophthora ramorum-infected coast live oaks following bark and ambrosia beetle colonization in northern California. Forest Ecology and Management 291: 30-42. https://doi.org/10.1016/j.foreco.2012.11.010

Meshram V, Sharma G, Maymon M, Protasov A, Mendel Z, Freeman S (2022) Symbiosis and pathogenicity of Geosmithia and Talaromyces spp. associated with the cypress bark beetles

Ophiostoma novo-ulmi and Geosmithia spp. on elm and insect 265

Phloeosinus spp. and their parasitoids. Environmental Microbiology 24(8): 3369-3389. https://doi.org/10.1111/1462-2920.16016

Ouellette GB, Rioux D, Simard M, Cherif M (2004a) Ultrastructural and cytochemical stud- ies of host and pathogens in some fungal wilt diseases: Retro- and introspection towards a better understanding of DED. Forest Systems 13(1): 119-145.

Ouellette GB, Rioux D, Simard M, Chamberland H, Cherif M, Baayen RP (2004b) Ultra- structure of the alveolar network and its relation to coating on vessel walls in elms in- fected by Ophiostoma novo-ulmi and in other plants affected with similar wilt diseases. Investigacion agraria. Sistemas y Recursos Forestales 13: 147—160.

Paine TD, Raffa KE, Harrington TC (1997) Interactions among scolytid bark beetles, their associated fungi, and live host conifers. Annual Review of Entomology 42(1): 179-206. https://doi.org/10.1146/annurev.ento.42.1.179

Pepori AL, Kolatik M, Bettini PP, Vettraino AM, Santini A (2015) Morphological and mo- lecular characterization of Geosmithia species on European elms. Fungal Biology 119(11): 1063-1074. https://doi.org/10.1016/j.funbio.2015.08.003

Pepori AL, Bettini PP, Comparini C, Sarrocco S, Bonini A, Frascella A, Ghelardini L, Scala A, Vannacci G, Santini A (2018) Geosmithia-Ophiostoma: A new fungus-fungus association. Microbial Ecology 75(3): 632-646. https://doi.org/10.1007/s00248-017-1062-3

Pepori AL, Michelozzi M, Santini A, Cencetti G, Bonello P Gonthier P, Luchi N (2019) Compar- ative transcriptional and metabolic responses of Pinus pinea to a native and a non-native Het- erobasidion species. Tree Physiology 39(1): 31-44. https://doi.org/10.1093/treephys/tpy086

Rioux D, Nicole M, Simard M, Ouellette GB (1998) Immunocytochemical evidence that se- cretion of pectin occurs during gel (gum) and tylosis formation in trees. Phytopathology 88: 494505. https://doi.org/10.1094/PHYTO.1998.88.6.494

Rizzo D, Da Lio D, Bartolini L, Cappellini G, Bruscoli T, Bracalini M, Moricca S (2020) A duplex real-time PCR with probe for simultaneous detection of Geosmithia morbida and its vector Pityophthorus juglandis. PLoS ONE 15(10): e0241109. https://doi.org/10.1371/ journal.pone.0241109

Rudinsky JA (1962) Ecology of Scolytidae. Annual Review of Entomology 7(1): 327-348. https://doi.org/10.1146/annurev.en.07.010162.001551

Santini A, Faccoli M (2015) Dutch elm disease and elm bark beetles: a century of association. iForest-Biogeosciences and Forestry 8(2): 126. https://doi.org/10.3832/ifor123 1-008

Six DL (2003) Bark beetle-fungus symbioses. Insect symbiosis 1: 97-114. https://doi. org/10.1201/9780203009918.ch7

Six DL (2012) Ecological and evolutionary determinants of bark beetle-fungus symbioses. Insects 3: 339-366. https://doi.org/10.3390/insects3010339

Six DL, Wingfield MJ (2011) The role of phytopathogenicity in bark beetle-fungus symbioses: a challenge to the classic paradigm. Annual Review of Entomology 56: 255-272. https:// doi.org/10.1146/annurev-ento-120709-144839

Spierenburg T (1921) Een onbekende ziekte in deiepen [An unknown disease in elm]. Tijdschrift over Plantenziekten 27: 53-61. https://doi.org/10.1007/BF02812411

Stipes RJ, Campana R (1981) Compendium of elm diseases American Phytopathological Society, St Paul, MN, USA, 66 pp. http://wwwcabdirectorg/abstracts/19811376781.html

266 Alessia L. Pepori et al. / NeoBiota 84: 247-266 (2023)

Stokland JN, Siitonen J, Jonsson BG (2012) Biodiversity in dead wood. Cambridge university press, 1-12. https://doi.org/10.1017/CBO9781139025843

Strzatka B, Kolartk M, Jankowiak R (2021) Geosmithia associated with hardwood-infesting bark and ambrosia beetles, with the description of three new species from Poland. Antonie van Leeuwenhoek 114(2): 169-194. https://doi.org/10.1007/s10482-020-01510-6

Sutherland ML, Brasier CM (1995) Effect of d-factors on in vitro cerato-ulmin production by the Dutch elm disease pathogen Ophiostoma novo-ulmi. Mycological Research 99(10): 1211-1217. https://doi.org/10.1016/S0953-7562(09)80281-5

Veselska T, Kolatik M (2015) Application of flow cytometry for exploring the evolution of Geosmithia fungi living in association with bark beetles: The role of conidial DNA content. Fungal Ecology 13: 83-92. https://doi.org/10.1016/j.funeco.2014.08.007

Webber JF (1990) Relative effectiveness of Scolytus scolytus, S. multistriatus and S. kirschi as vec- tors of Dutch elm disease. European Journal of Forest Pathology 20: 184—192. https://doi. org/10.1111/j.1439-0329.1990.tb01129.x

Webber JF (2000) Insect vector behaviour and the evolution of Dutch elm disease. In: Dunn CP (Ed.) The elms: breeding, conservation and disease management. Kluwer Academic Publishers, Boston, 47-60. https://doi.org/10.1007/978-1-4615-4507-1_3

Webber JF, Brasier CM (1984) The transmission of Dutch elm disease: a study of the process involved. In: Anderson JM, Rayner ADM, Walton D (Eds) Invertebrate-Microbial Interac- tions. Cambridge University Press, Cambridge, 271-306.

Webber JE, Gibbs JN (1984) Colonization of elm bark by Phomopsis oblonga. ‘Transactions of the British Mycological Society 82(2): 348-352. https://doi.org/10.1016/S0007- 1536(84)80083-2

Webber JE, Gibbs JN (1989) Insect dissemination of fungal pathogens of trees. In: Wilding N, Collins NM, Hammond PM, Webber JF (Eds) Proceedings of the 14° Symposium of the Royal Entomological Society of London / British Mycological Society “Insect-Fungus Interactions. Academic Press, London, 541-546. https://doi.org/10.1016/B978-0-12- 751800-8.50013-6

Webber JE, Hedger JN (1986) Comparison of interactions between Ceratocystis ulmi and elm bark saprobes in vitro and in vivo. Transactions of the British Mycological Society 86(1): 93-101. https://doi.org/10.1016/S0007-1536(86)80120-6

Webber JE Kirby JN (1983) Host feeding preference of Scolytus scolytus. Forest Commission Bulletin 60: 47—49.